Experimental variables of optical tweezers instrumentation that affect RNA folding/unfolding kinetics were investigated. A model RNA hairpin, P5ab, was attached to two micron-sized beads through hybrid RNA/DNA handles; one bead was trapped by dual-beam lasers and the other was held by a micropipette. Several experimental variables were changed while measuring the unfolding/refolding kinetics, including handle lengths, trap stiffness, and modes of force applied to the molecule. In constant-force mode where the tension applied to the RNA was maintained through feedback control, the measured rate coefficients varied within 40% when the handle lengths were changed by 10 fold (1.1 to 10.2 Kbp); they increased by two- to three-fold when the trap stiffness was lowered to one third (from 0.1 to 0.035 pN/nm). In the passive mode, without feedback control and where the force applied to the RNA varied in response to the end-to-end distance change of the tether, the RNA hopped between a high-force folded-state and a low-force unfolded-state. In this mode, the rates increased up to two-fold with longer handles or softer traps. Overall, the measured rates remained with the same order-of-magnitude over the wide range of conditions studied. In the companion paper (1), we analyze how the measured kinetics parameters differ from the intrinsic molecular rates of the RNA, and thus how to obtain the molecular rates.
Deep Dive into Force unfolding kinetics of RNA using optical tweezers. I. Effects of experimental variables on measured results.
Experimental variables of optical tweezers instrumentation that affect RNA folding/unfolding kinetics were investigated. A model RNA hairpin, P5ab, was attached to two micron-sized beads through hybrid RNA/DNA handles; one bead was trapped by dual-beam lasers and the other was held by a micropipette. Several experimental variables were changed while measuring the unfolding/refolding kinetics, including handle lengths, trap stiffness, and modes of force applied to the molecule. In constant-force mode where the tension applied to the RNA was maintained through feedback control, the measured rate coefficients varied within 40% when the handle lengths were changed by 10 fold (1.1 to 10.2 Kbp); they increased by two- to three-fold when the trap stiffness was lowered to one third (from 0.1 to 0.035 pN/nm). In the passive mode, without feedback control and where the force applied to the RNA varied in response to the end-to-end distance change of the tether, the RNA hopped between a high-force
Discovery of RNA's increasing roles in many biological processes, such as regulation of gene expression, has stimulated interest in understanding how the RNA folds into native structures to perform its functions. Folding of the RNA is highly hierarchical, i.e., the primary sequence of an RNA molecule forms secondary structural elements through base pairs, which subsequently fold to tertiary domains/structures, usually through long-range interactions (2). Moreover, several domains from a large RNA can fold independently and then assemble into more complex structures (3,4). RNA folding is strongly affected by environmental factors, including magnesium ions. For example, the Tetrahymena ribozyme does not form a stable structure in low Mg 2+ concentrations, whereas Mg 2+ -stabilized kinetic traps (misfolded species) slow the folding of the RNA in high Mg 2+ concentrations (5). Kinetically trapped, alternatively folded conformers usually occur in vitro during folding of larger RNAs, and they can be thermodynamically stable and never fold into correct structures (6).
RNA folding/unfolding thermodynamics and kinetics are traditionally studied by changing the temperature (7,8) or denaturant (e.g., urea) concentration (9,10). These variables can affect the equilibria and rates of the RNA folding reactions. Recently, optical tweezers-based single-molecule techniques (11)(12)(13) have introduced another variable-mechanical force-to study RNA folding/unfolding (14,15). This new approach offers several advantages over the traditional methods. First, mechanical forces are involved in many biological processes, such as opening of RNA hairpins by helicases (16). Second, the progress of the reaction can be followed by a well-defined reaction coordinate (end-to-end distance of the RNA). Finally, an RNA molecule usually traverses intermediate conformations before folding to its native structure, and single-molecule approaches make the detection and characterization of the intermediate states more accessible than bulk methods (17,18).
To facilitate single-molecule manipulation in a typical optical tweezers unfolding experiment, the RNA of interest is attached to two micron-sized beads through molecular “handles”, which are generally double-stranded nucleic acids to physically separate the RNA from the beads and to prevent the interference of the bead surfaces. One bead is held in the optical trap and the other is attached to a micropipette. Kinetics of RNA folding and unfolding is studied by monitoring distance changes between the two beads in response to the applied forces. However, several factors in the experimental setup may affect the measured unfolding/refolding rates of RNAs, as has been shown in a recent report on a 20-bp DNA hairpin whose rates change with the stiffness of the optical trap (19).
Our goals in this study are to systematically investigate the experimental influences on the kinetics of RNA hairpins in a typical optical tweezers experiment, and to analyze the limitation of measurements under such conditions. P5ab, a simple 22-bp RNA hairpin derived from the Tetrahymena thermophila ribozyme (20), was used as a model. The folding/unfolding rates of the RNA were measured for different handle lengths (1.1, 3.2, 5.9, and 10.2 Kbp), different stiffness of the optical trap (0.1 and 0.035 pN/nm), and two modes of force control (constant-force and passive modes, see below for details). Signal-to-noise ratios (SNR) were calculated as a function of force, extension, and time to validate those measurements. In the companion paper (1), we applied a mesoscopic model to simulate RNA kinetics under comparable conditions. By comparing the results from experiments and theory, we were able to deduce the intrinsic molecular rates, the ideal folding/unfolding rates of the RNA under a fixed force and without flanking handles and beads (1). The current experimental and theoretical data will be helpful for future experimental designs to reduce instrumental influences on measurements of force-unfolding kinetics of RNA or DNA.
The DNA sequence corresponding to the P5ab RNA was synthesized (Operon, Huntsville, AL) and cloned into a 10.3 Kbp pREP4 vector (Invitrogen, Carlsbad, CA) between the Hind III and Xho I sites. Based on the cloned vector, four sets of primers were designed for PCR (polymerase chain reaction) to make different lengths of templates, with a T7 promoter sequence (TAATACGACTCACTATAGGG) (21) at the 5′ end. The lengths of the templates were 1.1, 3.2, 5.9, and 10.2 Kbp, corresponding to positions 33 -1152, 9356 -2231, 8019 -3534, and 5849 -5754, respectively, of the original pREP4 vector. The inserted P5ab sequence (Figure 1A) located approximately at the center of each template. RNA was produced by in vitro transcription; lengths and integrity of the products were verified by denaturing agarose gel electrophoresis. The RNA was annealed to two corresponding single-stranded DNA, handles A and B, which were respecti
…(Full text truncated)…
This content is AI-processed based on ArXiv data.
